Use GenomeDK

An introduction to the GDK system and basic commands tinyurl.com/GDKslides

Samuele Soraggi

Bioinformatics Research Centre, Nat

Dan Søndergaard

GenomeDK, Health

Manuel Peral Vazquez

Biomedicine, Health

2026-08-31

Some background

  • These slides are both a presentation and a small reference manual

  • We will try out some commands during the workshop

  • Official reference documentation: genome.au.dk

When you need to ask for help

  • Practical help:

    Samuele (BiRC, MBG) - samuele@birc.au.dk

  • Drop in hours:

    • Bioinformatics Cafe: https://abc.au.dk, abcafe@au.dk
    • Samuele (BiRC, MBG) - samuele@birc.au.dk
  • General mail for assistance

    support@genome.au.dk

Program

  • 10:00-11:00: What is a HPC, GenomeDK, How it works, File System, virtual environments

  • 11:00-12:00: desktop interface, new environment, transfer data, interactive job

  • 12:45-14:00: Hands-on

Get the slides

Webpage: https://tinyurl.com/GDKslides/

Slides will always be up to date in this webpage

GenomeDK’s ABC

Learn your way around the basics of the GenomeDK cluster.

Infrastructure

GenomeDK is a High performance computing (HPC) cluster, i.e. a set of interconnected computers (nodes). GenomeDK has:

  • computing nodes used for running programs (21000+ cores, 48GPUs, 0.75 or 1.5TB RAM per node)
  • storage nodes storing data in many hard drives (~23 PiB)
  • a network making nodes talk to each other
  • a frontend node from which you can send your programs to a node to be executed
  • a queueing system called slurm to prioritize the users’ program to be run

HPC cluster from the backside

One node being mounted

A single node with CPU and RAM

CPUs and cores

  • A CPU (Central Processing Unit) executes instructions from programs.

  • A CPU has multiple cores, each core can execute instructions independently at the cost of reduced bandwidth

High throughput computing

High throughput computing (HTC): a large number of tasks are executed in parallel to achieve high performance and efficiency.

Accessing a HPC

Powershell (Windows) or Terminal (MacOS, Linux) are powerful tools to interact with a HPC cluster.

 

Terminal for MacOS and Linux. This is called powershell in Windows.

 

Interactive desktop

GenomeDK also has an interactive desktop interface at desktop.genome.au.dk which can be used to access the cluster through a web browser. More on that later.

Terminals look old, but it gives you enormous flexibility through efficient commands and scripting possibilities.

An old “Dumb Terminal” from the 1970s

Getting access to GenomeDK

  • Creating an account happens through this form at genome.au.dk

  • Logging into GenomeDK happens through the command 1

    [local]$  ssh USERNAME@login.genome.au.dk
  • When first logged in, setup the 2-factor authentication by

    • showing a QR-code with the command

      [gdk]$  gdk-auth-show-qr
    • scanning it with your phone’s Authenticator app 2.

Access without password

It is nice to avoid writing the password at every access. If you are on the cluster, exit from it to go back to your local computer

[gdk]$  exit

 

Now we set up a public-key authentication. We generate a key pair (public and private) …

[local]$  ssh-keygen -t ed25519

Always press Enter and do not insert any password when asked.

… and create a folder on the cluster called .ssh to contain the public key …

[local]$  ssh USERNAME@login.genome.au.dk mkdir -p .ssh

 

… and finally send the public key to the cluster, into the file authorized_keys

[local]$  cat ~/.ssh/id_rsa.pub | ssh USERNAME@login.genome.au.dk 'cat >> .ssh/authorized_keys'
cat $env:USERPROFILE\.ssh\id_ed25519.pub | ssh USERNAME@login.genome.au.dk 'cat >> .ssh/authorized_keys'

 

After this, your local private key will be tested against GenomeDK’s public key every time you log in.

File System (FS) on GenomeDK

  • Directory structure
  • Absolute and Relative Paths
  • important folders
  • navigate the FS on the command line

How the FS is organized

Folders and files follow a hierarchy

  • / is the root folder of the filesystem - nothing is above that
  • the FS is shared across all machines and available to all users
  • home and faststorage are two of the folders in the root
  • projects are in /faststorage/project and linked to your home

Exercise:

Log in: ssh USERNAME@login.genome.au.dk

Note

Run a command = Type a command + Enter

  • Run pwd, You should see your home folder: /home/USERNAME
    • /home/USERNAME is an example of path.
    • pwd shows your current folder (WD, Working Directory)
    • you can write paths starting FROM the WD!
  • Run ls . to show the content of your WD (the dot .)

  • Run mkdir -p GDKintro to create a GDKintro folder

  • Run echo "hello" > ./GDKintro/file.txt to write hello in a file

  • Use ls -lh ./GDKintro to see if the text file is there with some info.

Relative and absolute paths

  • /home/USERNAME starts from the root /. It is an absolute path.
  • ./GDKintro starts from the WD. It is a relative path.

Look at the File system tree and answer to the following questions:

Something more about your home

After log in, you will find yourself into your private home folder, denoted by ~ or equivalently /home/username. Your prompt will look like this:

 

[username@node ~] 

which follows the format [username@node current_folder].

 

Warning

  • Do not fill up your home folder with data. It has a limited amount of storage (a quota of 100GB).
  • Your home folder is private to you only

Exercise cont’d

We now set the WD into GDKintro and remove all text files in it. Then we download a zipped fastq file, unzip it, and print a preview!

cd GDKintro

rm *.txt

wget https://github.com/hartwigmedical/testdata/raw/master/100k_reads_hiseq/TESTX/TESTX_H7YRLADXX_S1_L001_R1_001.fastq.gz \
     -O ./data.fastq.gz

gunzip data.fastq.gz

head data.fastq 

Some notes about the commands

  • rm *.txt removes all files ending with .txt. The symbol * is a wildcard for the file name

    Forever away

    There is no trash bin - removed files are lost forever - with no exception

  • head prints the first lines of a text file

Exercise: Read files

Useful utility 1: less file reader. less is perfect for exploring (big) text files: you can scroll with the arrows, and quit pressing q. Try


less data.fastq

  The very first sequence you see should be

@HISEQ_HU01:89:H7YRLADXX:1:1101:1116:2123 1:N:0:ATCACG
TCTGTGTAAATTACCCAGCCTCACGTATTCCTTTAGAGCAATGCAAAACAGACTAGACAAAAGGCTTTTAAAAGTCTA
ATCTGAGATTCCTGACCAAATGT
+
CCCFFFFFHHHHHJJJJJJJJJJJJHIJJJJJJJJJIJJJJJJJJJJJJJJJJJJJHIJGHJIJJIJJJJJHHHHHHH
FFFFFFFEDDEEEEDDDDDDDDD

Challenge yourself

Search online man less (or with less --help) how to look for a specific word in a file with less. Then visualize the data with less, and try to find if there is any sequence of ten adjacent Ns (which is, ten missing nucleotides). Then, answer the question below

Exercise: Write files

Useful utility 2: nano text editor. It open, edits and saves text files. Very useful for changes on the fly.

  • Try nano data.fastq. Change a base in the first sequence,

  • then press Ctrl+O to save (give it a new file name newData.fastq and press Enter)

  • press Ctrl+X to exit. If you use ls you can see the new saved file.

Project management

  • What are GDK projects
  • how to track the resource usage, and
  • how to organize a project

GDK projects

what is a project

Projects are contained in /faststorage/project/ and linked in your home, and are simple folders with some perks:

  • you have to request their creation to GDK administrators
  • access is limited to you, and users you invite
  • CPU, GPU, storage and backup usage are registered under the project for each user
  • you can keep track of per-project and -user resource usage

Common-sense in project creation

  • Do not request a lot of different small project, but make larger/comprehensive ones
    • No-go example: 3 projects bulkRNA_mouse, bulkRNA_human, bulkRNA_apes with the same invited users
    • Good example: one project bulkRNA_studies with subfolders bulkRNA_mouse, bulkRNA_human, bulkRNA_apes.
  • Why? Projects cannot be deleted, so they keep cumulating

Creation

Request a project (after login on GDK) with the command

gdk-project-request -g <project_name>

 

After GDK approval, a project folder with the desired name appears in ~ and /faststorage/project. You should be able to set the WD into that folder:

cd <project_name>

or

cd ~/<project_name>

Users management

Only the creator (owner) can see the project folder. You (and only you) can add an user

gdk-project-add-user -g <project name> -u <username>

 

or remove it

gdk-project-remove-user -g <project name> -u <username>

Users can also be promoted to have administrative rights in the project

gdk-project-promote-user -g <project name> -u <username>

 

or demoted from those rights

gdk-project-demote-user -g <project name> -u <username>

Accounting

You can see globally monthly used resources of your projects with

gdk-project-usage

 

Example output:

project               period  billing hours  storage (TB)  backup (TB)  storage files  backup files
HDSSandbox            2024-8          44.58          0.09         0.00           6024             0
HDSSandbox            2024-9          25.38          0.09         0.00           6025             0
ngssummer2024         2024-6           6.73          0.00         0.00              0             0
ngssummer2024         2024-7        7547.48          0.72         0.00          27479             0

More detailed usage: by users on a selected project  

You can see how many resources your projects are using with

gdk-project-usage -u -p <project-name>

 

Example output:

project               period  billing hours  storage (TB)  backup (TB)  storage files  backup files
ngssummer2024  sarasj             2024-7          77.98          0.02         0.00            528             0
ngssummer2024  sarasj             2024-8           0.00          0.02         0.00            528             0
ngssummer2024  savvasc            2024-7         223.21          0.02         0.00            564             0
ngssummer2024  savvasc            2024-8           0.00          0.02         0.00            564             0
ngssummer2024  simonnn            2024-7         173.29          0.01         0.00            579             0
ngssummer2024  simonnn            2024-8           0.00          0.01         0.00            579             0

Accounting Tips

  • You can pipe the accounting output into grep to isolate specific users and/or months:
gdk-project-usage -u -p <project-name> | grep <username> | grep <period>

 

  • all the accounting outputs can be saved into a file, which you can later open for example as Excel sheet.

Example:

gdk-project-usage > accountingGDK.csv

Private files or folders

You have a folder or a file into the project which you do not want to share: Use

chmod -R go-rwx <file or folder>

 

which you can revert using

chmod -R go+rwx <file or folder>

Note: you cannot authorize only specific users to access data - you can only operate on the project members’ level.

Folders management

Have a coherent folder structure - your future self sends manu thanks.

Example of structure, which backs up raw data and analysis

If your project has many users, a good structure can be

MUST-KNOWs for a GDK project

  • remove unused intermediate files
    • unused and forgotten object filling up storage
  • backup only the established truth of your analysis
    • in other words the very initial data of your analysis, and the scripts
  • outputs of many files should be removed or zipped together into one
    • otherwise GDK indexes all of them: slow!!!

 

Backup cost >>> Storage cost >> Computation cost

Software management

 

  • No preinstalled software on GenomeDK

  • You install and manage your software and its dependencies inside virtual environments

Virtual environments

Each project needs specific software versions dependent on each other for reproducibility - without interferring with other projects.

 

Definition

A virtual environment keeps project-specific softwares and their dependencies separated

 

A package manager is a software that can retrieve, download, install, upgrade packages easily and reliably

How virtual envs work: packages at different versions are kept separated into folders, together with all system files needed to make them work.

Conda

 

Conda is both a virtual environment and a package manager.

  • easy to use and understand
  • can handle quite big environments
  • environments are easily shareable
  • a large archive (Anaconda) of packages
  • active community of people archiving their packages on Anaconda

Pixi

A newer virtual env and package manager

 

  • An upgrade of Conda in speed and stability
  • Can install the same packages as conda

A package manager puts together the dependency trees of requested packages to find all compatible dependencies versions.

Figure: A package’s dependency tree with required versions on the edges

To install a specific package in your environment, search it on anaconda.org:

Figure: search DeSeq2 for R

Channels

packages are archived in channels. conda-forge and bioconda include most of the packages for bioinformatics and data science.

conda-forge packages are often the most up-to-date.

Exercise - Pixi

First of all, we open the desktop interface to GenomeDK at desktop.genome.au.dk. Choose the open frontend for the login.

The desktop session will be operative even if you close and reopen your browser afterwards!

The terminal will work as if you logged into the frontend (The desktop is logged into the front-end node already). You can also use the browser!

Open the terminal and run the command below to install pixi:

curl -fsSL https://pixi.sh/install.sh | bash

After that, make the system recognize pixi

echo PATH="$PATH:$HOME/.pixi/bin" >> ~/.bashrc
echo 'eval "$(pixi completion --shell bash)"'  >> ~/.bashrc
source ~/.bashrc

Change your WD with the one we created earlier, where we have the file data.fastq

cd ~/GDKintro

Initiate a new pixi environment into the folder:

pixi init --channel conda-forge --channel bioconda

This will also use conda-forge and bioconda as channels for package installation.

What are channels?

Channels are repositories where packages are stored.

conda-forge and bioconda are two of the most used channels for bioinformatics and data science and contain virtually any package you may need.

Note that we specified channels in the order of priority: conda-forge has higher priority than bioconda when installing packages, so you will always search for a package first in conda-forge and then in bioconda.

Use the file browser and open the GDKintro folder

You can see some new files. pixi.toml contains info pixi will use to create your environment.

Open pixi.toml with the text editor, and make sure you have the two channels conda-forge and bioconda as you required with the pixi init command. You can always add more channels if you find out later that you need them for specific packages

Now get back to the terminal and install some packages. Your working directory MUST be the same where pixi.toml is located!

pixi add rstudio-desktop jupyterlab r-ggplot2 r-dplyr pandas

 

The terminal will look like this at the end

Now open the pixi.toml file. You should see all the installed packages with related information.

Tip

You can share pixi.toml with a collaborator. This will need to run pixi install and will recreate the same environment!

Does your collaborator need a file environment.yml to recreate the environment? Run

pixi project export conda-environment environment.yml

Exercise Cont’d

Be sure your WD is in the folder GDKintro. Then run

pixi project export conda-environment environment.yml

Open the file environment.yml. It looks very similar to pixi.toml and is compatible with conda to recreate your environment.

Let’s zip those files into one:

zip environment.zip pixi.toml environment.yml

Data transfer

Data can be downloaded/uploaded in two ways:

  • from the command line of a local computer

  • using an interactive interface (Filezilla)

Exercise cont’d - Download on shell

How to download the environment files to our computer? Open a terminal on your computer and run this command:

scp USERNAME@login.genome.au.dk:/home/USERNAME/GDKintro/environment.zip .

scp needs your login and the absolute path to the file. We give also the download destination as the WD on the local computer (.)

Tip

You can also upload a file switching the order of origin and destination in scp. E.g.

scp ./myFile.txt USERNAME@login.genome.au.dk:/home/USERNAME/GDKintro/myFile.txt 

Exercise - Download interactively

You can transfer data with an interactive software, such as Filezilla, which has an easy interface. Download Filezilla.

 

When done, open Filezilla and use the following information on the login bar:

  • Host: login.genome.au.dk
  • Username, Password: your GenomeDK username and password
  • Port: 22

Press on Quick Connect. As a result, you will establish a secure connection to GenomeDK after 2-factor authentication. On the left-side browser you can see your local folders and files. On the right-side, the folders and files on GenomeDK starting from your home.

Download the environment.zip file. You need to right-click on it and choose Download

You can do exactly the same to upload files from your local computer!

Running a Job

 

Running programs on a computing cluster happens through jobs.

 

Learn how to get hold of computing resources to run your programs.

What is a job on a HPC

A computational task executed on requested HPC resources (computing nodes), which are handled by the queueing system (SLURM).

The command gnodes will tell you if there is heavy usage across the computing nodes

Usage of computing nodes. Each node has a name (e.g. cn-1001). The symbols for each node mean running a program (0), assigned to an user (_) and available (.)

Front-end nodes are limited in memory and power, and should only be for basic operations such as

  • starting a new project

  • small folders and files management

  • small software installations

  • data transfer

and in general you should not use them to run computations. This might slow down all other users on the front-end.

Interactive jobs

Useful to run a non-repetitive task interactively

Examples:

  • splitting by chromosome that one bam file you just got

  • open Rstudio and Jupyterlab

  • compress/decompress multiple files, maybe in parallel

Once you exit from the job, anything running into it will stop.

Exercise: Interactive job

You can also run an interactive job on GenomeDK desktop. Go back to it and use the terminal to go into the GDKintro folder:

cd ~/GDKintro

Now run an interactive job. Use 8g of RAM, 2 cores, and choose 01:00:00 hours. Choose the account using the name of one of your projects, or delete it if you do not have projects.

srun --mem=8g -c 2 --time=01:00:00  --account=PROJECT_NAME --pty /bin/bash

You will have to wait in queue. When you get the resources, the node in use is shown in the prompt. Below, for example, the node is s21n32.

[USERNAME@s21n32 ~]$

Now, run rstudio or jupyterlab (your choice!) from the pixi environment:

pixi run rstudio
pixi run jupyter-lab --port=$UID --ip=$HOSTNAME

The packages available in Rstudio and Jupyterlab are the ones installed in your environment. More on this will be in our Advanced GenomeDK workshop.

Closing the workshop

Please fill out this form :)

  • A lot of things we could not cover

  • use the official documentation!

  • ask for help, use drop in hours

  • try out stuff and google yourself out of small problems

  • Slides updated over time, use as a reference

  • Future workshops about advanced usage and pipelines